guide rna Search Results


92
Addgene inc guide rna
Guide Rna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pmc05797955-433-8-19?v=Addgene+inc
Average 92 stars, based on 1 article reviews
guide rna - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

93
Addgene inc cdr1as sequence
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Cdr1as Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pmc06754938-61-5-17?v=Addgene+inc
Average 93 stars, based on 1 article reviews
cdr1as sequence - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
GenScript corporation aldh2 crispr guide rna cccgctcgatcagatcggcc
The expression levels of <t>CDR1as</t> in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.
Aldh2 Crispr Guide Rna Cccgctcgatcagatcggcc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pm40558540-73-0-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
aldh2 crispr guide rna cccgctcgatcagatcggcc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Broad Institute Inc lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg)
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Lentivirus Encoding A Guide Rna (Grna) For Gpr137b (Cgtgaagctcggcctcaccg), supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pmc06708790-199-0-17?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
lentivirus encoding a guide rna (grna) for gpr137b (cgtgaagctcggcctcaccg) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation 20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′)
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
20 Bp Guide Rna (Grna) Sequence (5′ Catggagttcccgttcgatg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pmc11105004-138-2-19?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
20-bp guide rna (grna) sequence (5′-catggagttcccgttcgatg-3′) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation guide rna sequences
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Guide Rna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/bio_rxiv__2024__07__01__598556-46-5-9?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
guide rna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biospring guide rna
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Guide Rna, supplied by Biospring, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/us11459372-2045-20-22?v=Biospring
Average 90 stars, based on 1 article reviews
guide rna - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation single guide rna (sgrna) targets
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Single Guide Rna (Sgrna) Targets, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pm39891251-72-0-25?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
single guide rna (sgrna) targets - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’)
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Tom20 Crispr Guide Rna Sequence (5’ Taagctcccaacaattagtc 3’), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/10__1074_slash_jbc__ra118__006693-184-10-28?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
tom20 crispr guide rna sequence (5’ taagctcccaacaattagtc 3’) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
BioRay Inc single-guide rna (sgrna) designed to target ripk3 kinase domain
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Single Guide Rna (Sgrna) Designed To Target Ripk3 Kinase Domain, supplied by BioRay Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pm28445730-164-20-23?v=BioRay+Inc
Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) designed to target ripk3 kinase domain - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation custom guide rna library
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Custom Guide Rna Library, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pm39656538-328-3-8?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
custom guide rna library - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA <t>lentivirus.</t> (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/guide+rna/pm38307859-283-32-48?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: The expression levels of CDR1as in periodontal ligament tissues and PDLSCs. (a) The expression of CDR1as in normal tissues ( n = 11) and periodontitis tissues ( n = 10) was determined by RT-qPCR. ∗ p < 0.01 vs. normal. (b) The TNF- α protein level secreted in the medium by PDLSCs treated with LPS was measured with an ELISA kit. Untreated PDLSCs (0 h) were used as control. ∗ p < 0.01 vs. control, ∗∗ p < 0.05 vs. 3 h. (c) IL-8 and IL-18 protein levels secreted in the medium by PDLSCs treated with LPS at 10 μ g/ml for 3 h were measured with an ELISA kit. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control. (d) The expression levels of CDR1as in LPS-treated PDLSCs were analyzed by RT-qPCR. Untreated PDLSCs were used as control. ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Control

circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: circRNA CDR1as mediated LPS-induced inhibition of PDLSC proliferation. (a) A standard curve of cell proliferation and mathematical formula describing OD value and cell number. Cell proliferation of PDLSCs was assessed by CCK-8 assay as indicated with cell numbers in reference to this standard curve obtained under the same conditions in all subsequent experiments. (b) Cell number of LPS-treated PDLSCs was less than that of untreated cells at each examined day, ∗ p < 0.01. (c) The efficiency of knockdown of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. si-NC. (d) The effects of knockdown of CDR1as on the proliferation of PDLSCs. ∗ p < 0.01 vs. control. (e) The efficiency of overexpression of CDR1as in PDLSCs was determined by RT-qPCR. ∗ p < 0.01 vs. over-NC. (f) The effects of overexpression of CDR1as on the proliferation of PDLSCs, ∗ p < 0.01 vs. control.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, CCK-8 Assay, Knockdown, Quantitative RT-PCR, Control, Over Expression

CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Journal: Mediators of Inflammation

Article Title: circRNA CDR1as Regulated the Proliferation of Human Periodontal Ligament Stem Cells under a Lipopolysaccharide-Induced Inflammatory Condition

doi: 10.1155/2019/1625381

Figure Lengend Snippet: CDR1as/miR-7 regulated LPS-induced inhibition of PDLSC proliferation by targeting ERK. (a) The efficiency of transient transduction of miR-7 mimics and miR-7 inhibitor evaluated by RT-qPCR. ∗ p < 0.01 vs. miR-NC. (b) The effects of miR-1 mimic and inhibitor on the proliferation of PDLSCs. After being transfected with miR-NC, miR-7 mimic, or miR-7 inhibitor, PDLSCs were treated with LPS at 10 ng/ μ l for 3 h and cultured for another 3 days with an initial seeding density of 2000 cell/well. Cell proliferation was evaluated by CCK-8 kits. ∗ p < 0.01 vs. miR-NC. (c) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with miR-7 mimic, miR-7 inhibitor, or miR-NC. ∗ p < 0.01 vs. miR-NC. (d) Western blot analysis of the protein expression of phospho-ERK, total-ERK, and the internal control GAPDH after transfection with siRNA-CDR1as alone or cotransfected with miR-7 inhibit or miR-7 mimic. ∗ p < 0.01 vs. siRNA-CDR1as. (e) The effects of siRNA-CDR1as cotransfected with miR-7 inhibit or miR-7 mimic on the cell proliferation of PDLSCs. ∗ p < 0.05 vs. siRNA-CDR1as.

Article Snippet: The expression plasmid for expressing CDR1as sequence was DNA3.1(+) CircRNA Mini Vector, a gift from Jeremy Wilusz (Addgene plasmid # 60648).

Techniques: Inhibition, Transduction, Quantitative RT-PCR, Transfection, Cell Culture, CCK-8 Assay, Western Blot, Expressing, Control

(A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA lentivirus. (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.

Journal: Bone

Article Title: A role for G protein-coupled receptor 137b in bone remodeling in mouse and zebrafish

doi: 10.1016/j.bone.2019.06.002

Figure Lengend Snippet: (A) Schematic of the Gpr137b gene indicating the gRNA target site on exon 1. (B-G) Differentiated Hoxb8 cells transduced with gRNA lentivirus. (B) Heteroduplex PCR followed by T7 Endonuclease I digestion detailing the presence of site-specific modification in the cells transduced with gRNA. (C) Western blot from membrane protein-enriched extracts showing GPR137b and LAMP-1 protein expression in control (eGFP) and transduced (Gpr137B−/−) cells. (D) Representative picture showing Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− cells differentiated on plastic and stained for TRAP activity. Scale bar 200μm. (E) Graph showing number of TRAP+ cells with 3 or more nuclei counted per cultured well and the average size of TRAP+ cells per well. (F-G) Hoxb8::eGFP and Hoxb8::gRNA gpr137b−/− were differentiated on osteo-assay plates. Cells were removed and the matrix was stained with von Kossa and pyrogallol to visualize the resorbtion pits (white spots). (F) Representative picture showing the matrix stained after 10 days of culture. Scale bar 500 μm. (G) Graph showing the quantification of resorbed area per well. Graphs represent mean±SD, **p<0.01, ****p<0.0001 determined by unpaired Student’s t-test or Mann Whitney test.

Article Snippet: Lentivirus encoding a guide RNA (gRNA) for Gpr137b (CGTGAAGCTCGGCCTCACCG) or EGFP control (GAAGTTCGAGGGCGACACCC) were generated by the Broad Institute Genetic Perturbation Platform (Cambridge, MA) using the pXPR_003 vector.

Techniques: Transduction, Modification, Western Blot, Membrane, Expressing, Control, Staining, Activity Assay, Cell Culture, MANN-WHITNEY